CRISPR-Cas9 gene editing of ADE2 in Saccharomyces cerevisiae

Page 1 of 45
Student Name: ____________________________________
Practical group: ____________________________________
Faculty of Life Sciences & Medicine
School of Bioscience Education
Department of Genetics
5BBG0204 Human and Molecular Genetics B
Practical Handbook 2021-2022
Semester 2
15 Credits: Level 5
Version 6th January 2022
Page 2 of 45
Contents
General safety precautions for practical classes …………………………………………………………………………………………..3
Gilson pipette information……………………………………………………………………………………………………………………………. 4
Use of Bunsen burners for aseptic technique………………………………………………………………………………………………….. 5
Practical. CRISPR-Cas9 gene editing of ADE2 in Yeast ………………………………………………………………………………………6
Introduction …………………………………………………………………………………………………………………………………………..6
Learning outcomes………………………………………………………………………………………………………………………………………. 7
Practical. Useful references………………………………………………………………………………………………………………………….. 8
Experimental plan …………………………………………………………………………………………………………………………………..9
Flow diagram of practical work……………………………………………………………………………………………………………………… 9
Day 1. Materials and Equipment ……………………………………………………………………………………………………………..10
Day 1. Transformation of competent yeast cells with plasmid pCASgRNA and HDR DNA fragment…………………….11
Part 1. Transformation of competent yeast cells with plasmid pCASgRNA and HDR DNA fragment ……………………… 11
Day 2. Materials and Equipment ……………………………………………………………………………………………………………..12
Day 2. Analysis of transformation results and steaking ADE2 mutants to single colonies………………………………….13
Part 1. Results of transformation of yeast competent cells…………………………………………………………………………….. 13
Part 2. Streaking ADE2 mutant colonies on new YPD+G418 agar plates…………………………………………………………… 14
Day 3. Materials and Equipment……………………………………………………………………………………………………………..16
Day 3. Isolation yeast ADE2 mutant genomic DNA and PCR amplification of ADE2 genomic DNA region ……………18
Part 1. Extraction yeast genomic DNA from ADE2 mutants…………………………………………………………………………….. 18
Part 2. PCR amplification of ADE2 from yeast genomic DNA…………………………………………………………………………… 20
Day 4. Materials and Equipment……………………………………………………………………………………………………………..22
Day 4. Analysis of ADE2 PCR products and preparation of DNA sequencing sample…………………………………………24
Part 1. Preparing a 1xTAE, 1% w/v agarose gel …………………………………………………………………………………………….. 24
Part 2. Purification of ADE2 PCR products with the Qiagen MiniElute PCR Purification kit………………………………….. 25
Part 3. Analysis of purified ADE2 PCR products using agarose gel electrophoresis…………………………………………….. 27
1 kb plus DNA ladder (Invitrogen)……………………………………………………………………………………………………………….. 28
Part 4. Measuring DNA concentration of your purified ADE2 PCR products using the nanodrop technique and
preparation of sample for DNA sequencing…………………………………………………………………………………………………… 29
Preparation notes for practical………………………………………………………………………………………………………………..31
Page 3 of 45
General safety precautions for practical classes
1. Students must wear a lab coat which is fully done up at all times while in the practical class.
2. Students must wear safety glasses at all times while in the practical class.
3. Students must wear nitrile gloves at all times while in the practical class.
4. Students must not touch their own eyes, skin or hair while in the practical class.
5. Students must not eat, chew gum, drink or apply makeup while in the practical class.
6. Students must not use mobile phones or lap top computers or any similar electrical devise
while in any practical class that involves the wearing of nitrile gloves.
7. Students must remove lab coat, safety glasses and nitrile gloves when they leave the practical
class and wash their hands in the sinks at the exit before leaving the practical class.
8. All belongings apart from pens, the module handbook and calculators must be left at the
entrance of the practical lab.
9. Students must dispose of items used in the practical class in the correct way within the lab as
directed by the written clean up guidelines at end of each practical session.
10. All Gilson tips must be disposed of by ejecting the tip into the yellow cin bin on the bench. No
used Gilson tips should on the bench or in other containers.
Page 4 of 45
Gilson pipette information
You should have used Gilson Pipettes before. The diagrams below remind you of the maximum and
minimum volumes of P20, P200 and P1000 Gilson Pipettes.
P20
Minimum 1 µl to maximum 20 µl
1 µl 20 µl
P200
Minimum 20 µl to maximum 200 µl
20 µl 200 µl
P1000
Minimum 200 µl to maximum 1000 µl (a.k.a. 1 ml)
200 µl 1000 µl
0
1
0
2
0
0
0
2
0
2
0
0
0
2
0
1
0
0
Page 5 of 45
Use of Bunsen burners for aseptic technique
Bunsen burners have been routinely used for more than a century to create a sterile environment
in laboratories. Many research laboratories now use laminar hoods for sterile work, but this is not
possible in a practical class. When the Bunsen burner is turned to it hottest blue flame it creates a
‘sterile umbrella’ by burning the dust and other particles in the air that could contain microbes. The
figure below shows the principle of working close to a Bunsen burner to maintain a sterile
environment.
Using a Bunsen burner to create a
sterile working environment.
Page 6 of 45
Practical. CRISPR-Cas9 gene editing of ADE2 in Yeast
Introduction
The ability to easily produce precise, targeted changes (mutations) to the genomes of living
cells has been a long-term goal for genetic research, especially for eukaryotic organisms. A new
tool based on a bacterial CRISPR-associated protein-9 nuclease (Cas9) from Streptococcus pyogenes
has gained widespread use for direct editing of DNA sequences within specific genes. CRISPR
systems are naturally present in bacteria and are used as an adaptive DNA-based defence against
infection by DNA viruses. CRISPR systems can be adapted through genetic engineering to direct
targeted double-stranded DNA breaks in specific DNA sequences in many types of prokaryotic and
eukaryotic living cells. This gene editing system makes use of a DNA editing protein called the Cas9
nuclease, which is coupled to a small “guide RNA” that is designed to have sequence
complementarity to the DNA target site. For more precise gene editing, most CRISPR methods can
make use of the organism’s genomic Homology-Directed Repair mechanism (sometimes referred to
as “gap repair”) to introduce specific DNA changes into the targeted gene.
In this experiment a strain of Saccharomyces cerevisiae called BY4741 which is wild type for
the ADE2 gene will be mutated using a Crispr-Cas9 method to an ADE2 mutant strain. Yeast ADE2
mutants have a pink colour colony phenotype due to accumulation of the P-ribosylaminoimidazole
intermediate (Figure 1). To check the gene editing process yeast genomic DNA will be extracted
from ADE2 mutant strains and the mutated region amplified using PCR. The PCR fragment will be
purified and sent for DNA sequencing to check if the desired DNA sequence has been created.
Figure 1. Adenine Biosynthesis pathway in Saccharomyces cerevisiae
Page 7 of 45
Learning outcomes
After performing the all steps in the experiment students will
1. Be able to transform competent yeast cells with DNA and select for ADE2 mutants on agar media
plates.
2. Understand how to purify yeast genomic DNA.
3. Be able to set up a PCR to amplify the region of yeast genomic DNA containing the mutated
region of the ADE2 gene.
4. Have learned how to purify DNA after PCR amplification using the Qiagen MiniElute PCR
Purification kit.
5. Have learned how to quantify DNA using a nanodrop analyser and will have used this
information to adjust the DNA concentration of their DNA sample so it can be used for DNA
sequence analysis.
Though interpreting the practical results students will
1. Understand how the CRISPR-Cas system works and how to identify suitable guide RNAs.
2. Understand the principles behind the polymerase chain reaction and primer design.
3. Understand how the Zymo Research YeaStar Genomic DNA kit can be used purify yeast genomic
DNA.
4. Understand how the Qiagen MiniElute PCR Purification kit can be used purify DNA.
5. Understand how to analyse DNA sequencing data.
Page 8 of 45
Practical. Useful references
Barrangou, R. and L. Marraffini, L. 2014. CRISPR-Cas Systems: Prokaryotes Upgrade to Adaptive
Immunity. Molecular Cell 54, 234-244. https://doi.org/10.1016/j.molcel.2014.03.011
Doudna, J. A., & Charpentier, E. (2014). Genome editing. The new frontier of genome engineering
with CRISPR-Cas9. Science (New York, N.Y.), 346(6213), 1258096.
https://doi.org/10.1126/science.1258096
Pennisi, E. 2013. The CRISPR Craze. Science 341 (6148):833-836.
https://science.sciencemag.org/content/341/6148/833.full
Ryan, O. W., Skerker, J. M., Maurer, M. J., Li, X., Tsai, J. C., Poddar, S., Lee, M. E., DeLoache, W.,
Dueber, J. E., Arkin, A. P., & Cate, J. H. (2014). Selection of chromosomal DNA libraries using a
multiplex CRISPR system. eLife, 3, e03703. https://doi.org/10.7554/eLife.03703
Sehgal, N., Sylves, M. E., Sahoo, A., Chow, J., Walker, S. E., Cullen, P. J., & Berry, J. O. (2018). CRISPR
Gene Editing in Yeast: An Experimental Protocol for an Upper-Division Undergraduate Laboratory
Course. Biochemistry and molecular biology education : a bimonthly publication of the
International Union of Biochemistry and Molecular Biology, 46(6), 592–601.
https://doi.org/10.1002/bmb.21175
Kawai, S., Hashimoto, W., & Murata, K. (2010). Transformation of Saccharomyces cerevisiae and
other fungi: methods and possible underlying mechanism. Bioengineered bugs, 1(6), 395–403.
https://doi.org/10.4161/bbug.1.6.13257
Kawai, S., Hashimoto, W., & Murata, K. (2010). Transformation of Saccharomyces cerevisiae and
other fungi: methods and possible underlying mechanism. Bioengineered bugs, 1(6), 395–403.
https://doi.org/10.4161/bbug.1.6.13257
Useful web sites
YeaStar Genomic DNA Kit
Zymo Research YeaStar Genomic DNA kit (accessed November 2021)
https://www.qiagen.com/us/resources/resourcedetail?id=8f6b09b2-6dcd-4b55-bb4a255ede40ca3b&lang=en
Qiagen MinElute PCR Purification Kit (accessed November 2021)
https://www.agilent.com/cs/library/usermanuals/public/600850.pdf
PfuUltra II Hotstart PCR 2x Master Mix (accessed November 2021)
https://www.neb.com/tools-and-resources/feature-articles/crispr-cas9-and-targeted-genomeediting-a-new-era-in-molecular-biology
CRISPR/Cas9 and targeted genome editing: A new era in molecular biology. New England Biolabs.
(accessed November 2021)
Page 9 of 45
Experimental plan
Day 1. Transformation of competent yeast cells with plasmid pCASgRNA and HDR DNA fragment
Day 2. Analysis of transformation results and steaking ADE2 mutants to single colonies
Day 3. Purification of yeast ADE2 mutant genomic DNA and PCR amplification of ADE2 genomic
DNA region.
Day 4. Analysis of ADE2 PCR products and preparation of DNA sequencing sample.
Flow diagram of practical work
Page 10 of 45
Day 1. Materials and Equipment
Per student
1x P20 Gilson
1x P200 Gilson
1x P1000 Gilson
1x Eppendorf rack
1x Ice bucket with ice
1x box sterile P20 tips
1x box sterile P200 tips
1x box sterile P1000 tips
1x box sterile 1.5 ml tubes labelled 1.5 ml tubes
1x Permanent Marker pen
1x 100 µl competent yeast cells a 1.5 ml tube labelled yeast on lid (on ice)
1x 13 µl of 100 ng/µl pCASgRNA in sterile 1.5 ml tube labelled on pCASgRNA on lid (on ice)
1x 15 µl of 10 mg/ml ssDNA in sterile 1.5 ml tube labelled on ssDNA on lid (on ice)
1x 15 µl of 200 ng/µl HDR fragment in sterile 1.5 ml tube labelled on HDR lid (on ice)
1x 1000 µl of PLATE solution in sterile 1.5 ml tube labelled PLATE on lid (on ice)
1x 400 µl to sterile YPD broth in sterile 1.5 ml tube labelled YPD on lid (on ice)
2x YPD+G418 agar plates labeled YPD+G418
1x bag sterile plastic spreaders
1x Bunsen burner
1x 250 ml beaker labelled WASTE
1x electronic timer
On each bench
2x yellow cinbins
2x Microfuges with 1.5 ml tube inserts
1x Bunsen burner lighter
1 x roll autoclave tape
In practical laboratory
2x Heating blocks at 30C (1.5 ml tube metal blocks) spaced around lab (one hole per student)
2x Heating blocks at 42C (1.5 ml tube metal blocks) spaced around lab (one hole per student)
Spare tubes of 100 µl competent yeast cells a 1.5 ml tube labelled yeast on lid (at -70°C)
Spare of 100 ng/µl pCASgRNA in sterile 1.5 ml tube labelled on pCASgRNA on lid (at -20°C)
Spare tubes of 15 µl of 10 mg/ml ssDNA in sterile 1.5 ml tube labelled on ssDNA on lid (at -20°C)
Spare tubes of 15 µl of 200 ng/µl HDR fragment in sterile 1.5 ml tube labelled on HDR lid (at -20°C)
Spare tubes of 1000 µl of PLATE solution in sterile 1.5 ml tube labelled PLATE on lid (at RT)
Spare tubes of 400 µl to sterile YPD broth in sterile 1.5 ml tube labelled YPD on lid (at RT)
Spare YPD+G418 agar plates (at RT)
Spare boxes of sterile P20, P200 and P1000 tips
Spare boxes with sterile 1.5 ml tubes
Spare P20, P200 and P1000 Gilsons
Boxes small, medium and large nitrile gloves
Safety glasses (one pair per student)
Wire basket at front of class for plate incubation and storage
Page 11 of 45
Day 1. Transformation of competent yeast cells with plasmid pCASgRNA and HDR DNA fragment
Part 1. Transformation of competent yeast cells with plasmid pCASgRNA and HDR DNA fragment
You have been given a tube containing 100 µl of yeast competent cells (in your ice bucket).
You should always use a new Gilson tip for each addition and dispose of the tip in the yellow cinbin.
a. Write your initials/name on the top and sides of your tube of yeast competent cells.
b. Add 10 µl of 100 ng/µl pCASgRNA to the tube containing 100 µl of yeast competent cells.
c. Add 10 µl of 10 mg/ml ssDNA to the tube containing 100 µl of yeast competent cells.
d. Add 10 µl of 200 ng/µl HDR fragment to the tube containing 100 µl of yeast competent cells.
e. Add 900 µl of PLATE solution to the tube containing 100 µl of yeast competent cells.
f. Mix by gently pipetting up and down with a Gilson pipette set at 900 µl.
g. Place your tube containing the yeast cells in the 30°C heating block for 30 minutes.
h. After 30 minutes remove the tube from the heating block. To ensure all the cells are evenly
suspended mix by gently pipetting up and down with a Gilson pipette set at 900 µl.
i. Heat shock the yeast cells by placing your tube containing the yeast cells at 42°C heating block for
20 minutes.
j. Pellet the cells using a microfuge set at 5,000 rpm for 3 minutes.
k. Carefully remove the all the supernatant (clear solution above the cell pellet) with a Gilson
pipette set at 1000 µl. Do NOT disturb the cell pellet. Dispose the supernatant in the waste
beaker.
l. Add 250 µl to YPD broth to the tube containing your cell pellet and pipette gently up and down
to resuspend the cell pellet.
m. Place your tube containing the yeast cells in the 30°C heating block for 2 hours.
n. Label the bottom of two YPD+G418 agar plates with your name, date and Yeast pCASgRNA+HDR
(around the edge at the bottom of the plate)
o. After 30 minutes remove the tube from the heating block. Spread 125 µl of the transformed
yeast cells onto each of your two YPD+G418 agar plates.
p. Place a piece of autoclave tape around your two plates. Turn the stack agar side up and write
your name and date on the tape. Place your plates agar side up in the wire basket at the front of
the class.
Your plates will be incubated at 37°C for two days then 30°C for 2 days and then stored at 4°C
until the next class.
Page 12 of 45
Day 2. Materials and Equipment
Equipment per student
3x YPD+G418 agar plates
1x bag sterile inoculating loops
1x black marker pen
Bunsen burner
On each bench
2x yellow cinbin
1x roll autoclave tape
Bunsen burner lighter
In class
7 YPD+G418 agar plates of yeast ADE2 mutant streaked to single colonies
Boxes small nitrile gloves
Boxes medium nitrile gloves
Boxes large nitrile gloves
1x wire basket for plate incubation and storage
Page 13 of 45
Day 2. Analysis of transformation results and steaking ADE2 mutants to single colonies
Part 1. Results of transformation of yeast competent cells
Only yeast cells which contain the plasmid pCASgRNA can grow on YPD+G418 agar plates. Wild
type yeast colonies will look white. ADE2 mutant colonies will look fully pink (if the gene editing
event has happened shortly after transformation of the yeast cell). Some colonies may be a
mixture of pink and white sectors because the gene editing event has occurred during colony
growth and only some of the yeast cells in the colony have the ADE2 mutation.
By counting the number of colonies (a colony is derived from one yeast cell) grown on the
YPD+G418 agar plates we can get an idea of how well the experiment worked.
a. Take a photograph of both your plates for your practical report with your smart phone.
Make sure the two plates are placed side by side on the bench and fill the frame and are in focus.
If you do not have a smart phone ask a friend (or the lead academic) to do this for you and email
you the photographs.
b. Count and record number of the distinct different coloured colonies on each plate in the table
below.
Plate 1 Plate 2 Total
Number of distinct only white
colonies
Number of distinct only pink
colonies
Number of distinct white and
pink mixture colonies
Approximate number of
indistinct colonies
Page 14 of 45
Part 2. Streaking ADE2 mutant colonies on new YPD+G418 agar plates
We are going to extract genomic from ADE2 mutant colonies on Day 3 of the practical. We need to
be sure that the yeast cells we use for the genomic DNA extraction are only ADE2 mutant ones and
do not contain a mixture of wildtype and ADE2 mutant cells.
You have already streaked E. coli cells to single colonies in the second 4BBY1070 practical last year.
Please read the information below to ensure you understand how this technique is done.
Page 15 of 45

a. Select three fully pink distinct colonies on your YPD+G418 result plates and circle them.
If you have NO pink colonies on your YPD+G418 agar plates please see the lead academic for
advice.
b. Label one YPD+G418 agar plate with your name, date, ADE2 mutant 1
Label one YPD+G418 agar plate with your name, date, ADE2 mutant 2
Label one YPD+G418 agar plate with your name, date, ADE2 mutant 3
c. Take a single distinct pink ADE mutant colony and streak to single colonies on YPD+G418 agar
plate with your name, date, ADE2 mutant 1.
d. Take a second single distinct pink ADE mutant colony and streak to single colonies on YPD+G418
agar plate with your name, date, ADE2 mutant 2.
e. Take a third single distinct pink ADE mutant colony and streak to single colonies on YPD+G418
agar plate with your name, date, ADE2 mutant 3.
f. Place a piece of autoclave tape around your three plates. Turn the stack agar side up and write
your name on the tape. Place your plates agar side up in the wire basket at the front of the
class.
g. Your plates will be incubated at 30°C for 4 days and then stored at 4°C until the next class.
Page 16 of 45
Day 3. Materials and Equipment
Per student
1x P20 Gilson
1x P200 Gilson
1x P1000 Gilson
1x Eppendorf rack
1x PCR tube rack
1x Ice bucket with ice
1x Box sterile P200 tips
1x Box sterile P1000 tips
1x Box sterile 1.5 ml tubes labelled 1.5 ml tubes
1 x bag sterile disposable 1 μl inoculating loops
1x Permanent Marker pen
1x scissors
1x electronic timer
Materials per student
(from Zymo Research YeaStar Genomic DNA kit)
1x 280 µl YD Digestion buffer in sterile 1.5 ml tube labelled Digest buffer on lid
1 x 14 µl R-Zymolyase in sterile 1.5 ml tube labelled R-Zymolyase on lid (on ice)
1 x 280 µl YD Lysis buffer in sterile 1.5 ml tube labelled Lysis buffer on lid
1 x 1400 µl DNA wash buffer in sterile 1.5 ml tube labelled Wash Buffer on lid
2 x Zymo-spin III columns columns, 6 x 2 ml (no lid) collection tubes* in new plastic baggy
* need more 2ml lidless tubes than supplied by kit
Other materials
1 x 70 µl PfuUltra II Hotstart PCR Master mix in sterile 1.5 ml tube labelled Master mix (on ice)
1 x 20 µl ADE2 primers in sterile 1.5 ml tube labelled ADE2 primers on lid (on ice)
1 x 500 µl of sterile dH2O in sterile 1.5 ml tube labelled dH2O on lid
2 x 0.2 ml PCR tubes in new sterile Petri Dish
On each bench
2x yellow cinbin
1x roll autoclave tape
2x microfuge
2x vortex machines
In class
4x 37°C heating block with 1.5 ml tube inserts
PCR machine
PCR sign up sheet
2x microfuges with 0.2 ml red adapters (near PCR machine)
Boxes small nitrile gloves
Page 17 of 45
Boxes medium nitrile gloves
Boxes large nitrile gloves
1x safety glasses (one per student)
Spare 280 µl YD Digestion buffer in sterile 1.5 ml tube labelled Digest buffer on lid
Spare 14 µl R-Zymolyase in sterile 1.5 ml tube labelled R-Zymolyase on lid (-20°C)
Spare 280 µl YD Lysis buffer in sterile 1.5 ml tube labelled Lysis buffer on lid
Spare 1400 µl DNA wash buffer in sterile 1.5 ml tube labelled Wash Buffer on lid
Spare Zymo-spin III columns columns, 6 x 2 ml (no lid) collection tubes* in new plastic baggy
Spare 70 µl PfuUltra II Hotstart PCR Master mix in sterile 1.5 ml tube labelled Master mix (4°C)
Spare 20 µl ADE2 primers in sterile 1.5 ml tube labelled ADE2 primers on lid (-20°C)
Spare 500 µl of sterile dH2O in sterile 1.5 ml tube labelled dH2O on lid (-20°C)
Spare 0.2 ml PCR tubes in new sterile Petri Dish
Page 18 of 45
Day 3. Isolation yeast ADE2 mutant genomic DNA and PCR amplification of ADE2 genomic DNA
region
Part 1. Extraction yeast genomic DNA from ADE2 mutants
In this step you will extract yeast genomic DNA for two of your three ADE2 mutant strains using
Zymo Research YeaStar Genomic DNA Kit protocol 2.
a. Take a photograph of your three plates for your practical report with your smart phone.
Make sure the three plates are placed side by side on the bench and fill the frame and are in
focus.
If you do not have a smart phone ask a friend (or the lead academic) to do this for you and email
you the photographs.
b. Label the side of a 1.5 ml tube with your name and 1 and write 1 and your initials on the lid so
you can identify it easily.
c. Label the side of a second 1.5 ml tube with your name and 2 and write 2 and your initials on the
lid so you can identify it easily.
d. Add 120 μl of Digest buffer to each of the tubes 1 and 2.
e. Add 5 μl of R-Zymolyase to each of the tubes 1 and 2.
f. Using a sterile disposable 1 μl inoculating loop scrap up a distinct solely pink colony from one of
your YPD+G418 agar plates (steaked on Day 2) and place in the Digest buffer/R-Zymolyase in
tube 1. Twizzle the loop in the liquid to ensure all cells are in the Digest buffer/R-Zymolyase.
Record the number of plate you used here ………………..
g. Using a sterile disposable 1 μl inoculating loop scrap up a distinct solely pink colonies a different
YPD+G418 agar plate (steaked on Day 2) and place in the Digest buffer/R-Zymolyase in tube 2.
Twizzle the loop in the liquid to ensure all cells are in the Digest buffer/R-Zymolyase.
Record the number of plate you used here ………………..
Page 19 of 45
h. Resuspend the cells in tubes 1 and 2 by vortexing.
i. Place tubes 1 and 2 in the 37°C heating block for 40 to 60 minutes.
j. Add 120 μl of Lysis buffer to each of the tubes 1 and 2.
k. Vortex tubes 1 and 2 for 20 seconds.
l. Centrifuge tubes 1 and 2 in a microfuge set at 13,000 rpm for 2 minutes.
m. Label the lids of two Zymo-spin III columns 1 and 2 and place each in a 2 ml lidless collection
tube.
n. Load the supernatant (clear liquid ~ 240 μl) from tube 1 onto a Zymo-spin II column labelled 1.
Avoid the pellet of cell debris at the bottom of tube 1 when you take off the supernatant.
o. Load the supernatant (clear liquid ~ 240 μl) from tube 2 onto a Zymo-spin II column labelled 2.
Avoid the pellet of cell debris at the bottom of tube 2 when you take off the supernatant.
p. Centrifuge the two column/tube assemblies in a microfuge set at 13,000 rpm for 1 minute.
q. Transfer the two columns to two new lidless 2 ml tubes.
r. Add 300 μl of Wash buffer to each column.
s. Centrifuge the two columns/tube assemblies in a microfuge set at 13,000 rpm for 1 minute.
t. Transfer the two columns to two new lidless 2 ml tubes.
u. Add 300 μl of Wash buffer to each column.
v. Centrifuge the two columns/tube assemblies in a microfuge set at 13,000 rpm for 1 minute.
w. Label two 1.5. ml tubes (with lids cut off) genomic DNA 1 and genomic DNA 2.
x. Transfer the column labelled 1 into the 1.5 ml tube labelled genomic DNA 1.
y. Transfer the column labelled 2 into the 1.5 ml tube labelled genomic DNA 2.
Concentrate you are now going to elute your purified genomic DNA from the column using
dH2O.
Page 20 of 45
z. Add 60 μl of dH2O directly to the surface of the column 1 membrane.
Add 60 μl of dH2O directly to the surface of the column 2 membrane.
Wait for 1 minute.
aa. Centrifuge the two columns/tube assemblies in a microfuge set at 13,000 rpm for 10
seconds.
Check the bottom of each tube, you should see ~ 60 μl there. If you cannot see ~ 60 μl please
see the academic for advice.
ab. Place the two columns/tube assemblies in your rack.
Part 2. PCR amplification of ADE2 from yeast genomic DNA
a. Labelled two 0.2 ml PCR tubes 1 and 2 on the lid and sides of the tubes and add 1 and 2 and your
name on the side of each tube.
b. Pipette the following volumes into the bottom of each tube. You must use a new tip for each
addition. Check to make sure you have taken up these small volumes by looking at the tip,
dispense the volume at the bottom of the tube, and also check that the amount has been
dispensed (the tip is empty). Start with the water and then work down the table adding
ingredients in the order they appear. Tick off each ingredient on the list as you add it to the
correct PCR tube.
1 2
dH2O labelled dH2O 15 µl 15 µl
Primers labelled ADE2 primers 5 µl 5 µl
Genomic DNA 1 5 µl none
Genomic DNA 2 none 5 µl
Master mix 25 µl 25 µl
TOTAL VOLUME 50 µl 50 µl
c. Mix the contents of each tube by setting P200 Gilson to 45 µl and SLOWLY pipetting mixture up
and down a few times. Use a new tip for each tube.
d. Spin your tubes for 10 seconds in a microfuge (one with the red PCR tube adaptors) set at
maximum speed to ensure all the liquid is at the bottom of the tube.
e. Place your two PCR tubes in the PCR machine. Write your name in the right place on the PCR
sign-up sheet beside the machine in case you forget the position of your PCR tubes next week.
Page 21 of 45
The PCR programme is:
95°C, 2 minutes, 1 cycle.
then
95°C, 20 seconds (denaturation) Repeat 40 cycles.
55°C, 20 seconds (annealing)
72°C, 15 seconds (extension)
then
72°C, 3 minutes, 1 cycle.
then
4°C, hold.
g. Your tubes will be removed from the PCR machine later and stored at -20°C until next week.
Page 22 of 45
Day 4. Materials and Equipment
Per student
1x P20 Gilson
1x P200 Gilson
1x P1000 Gilson
1x Eppendorf racks
1x PCR tube rack
1x Ice bucket with ice
1x Box sterile P200 tips
1x Box sterile P1000 tips
1x Box sterile 1.5 ml tubes labelled 1.5 ml tubes
1x Permanent Marker pen
1x scissors
1x electronic timer
For agarose gel (per student)
1x 250 ml conical flask
1x 50 ml measuring cylinder
1x 250 ml measuring cylinder
1x mini gel apparatus with tray and 8 well comb
1x small sandwich box
1x pair heat resistant gloves
1x 8 l GelRed in 1.5 ml tube labelled GelRed on lid (room temp)*
1x 10 µl Promega Blue/orange 6x loading buffer in sterile 1.5 ml tube labelled 6xBO dye on lid
1x 15 µl Invitrogen 1 kb plus marker (50 ng/µl) in 1.5 ml labelled 1 kb plus on lid*
1x 500 µl sterile dH2O in 1.5 ml tube labelled sterile dH2O on lid
For purification of PCR product (per student)
(from Qiagen MinElute PCR Purification kit)
2x MiniElute columns and 6x 2 ml collection lid-less tubes* in plastic baggy
1x 450 µl Buffer PB in sterile 1.5 ml tube labelled PB on lid (room temp)
1x 1750 µl Buffer PE in sterile plastic Bijou bottle labelled PE on lid (room temp)
* need more 2ml lidless tubes than supplied by kit
On bench (per student)
1x standard power pack
1x yellow cinbin
1x Microfuge with 1.5 ml tube insert
Roll of autoclave tape
Stapler and staples
Page 23 of 45
In practical laboratory FWB 3.142
The spares should be in three locations in FWB 3.142, one room temperature, one 4˚C,
one -20˚C).
Computer with internet access and AV and screens around class switched on before students enter
and tie microphone with spare battery.
1.5 ml tube freezer storage box with tape label on ice (for DNA sequencing samples).
1x Gel imaging system and printer (and spare paper for printer)
1x Nanodrop machine (and spare paper for printer)
1x P10 Gilson and 1 x box P10 tips for demonstrator to use next to nanodrop
1x 100 ml sterile dH2O for demonstrator to use next to nanodrop
1x squeezy bottle with dH2O for demonstrator to use next to nanodrop
1x box Mediwipe tissues for demonstrator to use next to nanodrop
20 litres 1xTAE in Dewar with tap
6x microwaves
6x weighting scales (0.001g)
6x pots of agarose (molecular biology grade)
6x spatulas
Weighing boats
Boxes small, medium and large nitrile gloves
Safety glasses
Spare sterile P200 tips in boxes
Spare sterile P1000 tips in boxes
Spare boxes sterile 1.5 ml tubes
Spare P20 Gilsons
Spare P200 Gilsons
Spare P1000 Gilsons
Spare 8 l GelRed in 1.5 ml tube labelled GelRed on lid (room temp)*
Spare 10 µl Promega Blue/orange 6x loading buffer in sterile 1.5 ml tube labelled 6xBO dye on lid (-
20°C)
Spare 15 µl Invitrogen 1 kb plus marker (50 ng/µl) in 1.5 ml labelled 1 kb plus on lid*(-20°C)
Spare 500 µl sterile dH2O in 1.5 ml tube labelled sterile dH2O on lid (-20°C)
Spare MiniElute columns and 6x 2 ml collection lid-less tubes* in plastic baggy
Spare 450 µl Buffer PB in sterile 1.5 ml tube labelled PB on lid (room temp)
Spare 1750 µl Buffer PE in sterile plastic Bijou bottle labelled PE on lid (room temp)
Page 24 of 45
Day 4. Analysis of ADE2 PCR products and preparation of DNA sequencing sample
Part 1. Preparing a 1xTAE, 1% w/v agarose gel
a. Add 50 ml of 1x TAE to a 250 ml conical flask. Add 0.5 g of agarose to the 1xTAE (try not to get
solid agarose up the sides of the conical flask as it will not melt into solution easily if you do this).
b. Heat in microwave at full power for 1 – 2 minutes until solution has just boiled. Take the flask
out of microwave wearing heat resistant gloves and swirl gently for 30 seconds. Reheat the agarose
mixture for few more seconds in microwave until liquid is just boiling. Take the flask out of
microwave wearing heat resistant gloves and swirl gently for 30 seconds.
c. Add 5 µl GelRed to the melted agarose and swirl.
d. Tape the sides of the gel tray as shown by the lead academic. Place the 8 well comb in the slot at
one end of the tray (the side of the bridge with the comb attached positioned furthest from the
edge of the gel tank). When the agarose gel has reach stage where you can just hold the bottom of
flask in your hand (approx. 60°C) pour it into the gel tray and allow the agarose gel to set. Rinse out
the conical flask in the sink and leave the flask in the sink. N.B. The tray/gel/comb must not be
moved or jogged while the agarose is setting so position the gel tray towards the back of bench.
You will need to leave the agarose gel to set for at least 30 minutes.
Record time gel poured…………………………………………..
Page 25 of 45
Part 2. Purification of ADE2 PCR products with the Qiagen MiniElute PCR Purification kit
a. Label a new 1.5 ml tube with PCR1 and your name. Remove 40 µl from your own 0.2 ml PCR1
tube and place in a new 1.5 ml tube labelled with your name.
b. Label a new 1.5 ml tube with PCR2 and your name. Remove 40 µl from your own 0.2 ml PCR2
tube and place in a new 1.5 ml tube labelled with your name.
CAUTION. There are two solutions both starting with P labelled PB and PE, so make sure you use
the right one in each step.
c. Add 200 µl of Buffer PB to each of the two 1.5 ml tubes containing your PCR1 and PCR2 and mix by
pipetting up and down a few times.
d. Take a MiniElute column (already in a 2 ml tube) from the plastic baggy. Write WASTE 1 on the
side of the tube and PCR1 column lid. Add 240 µl of the PCR1-BufferPB mixture to the column.
e. Take a MiniElute column (already in a 2 ml tube) from the plastic baggy. Write WASTE 1 on the
side of the tube and PCR2 column lid. Add 240 µl of the PCR2-BufferPB mixture to the column.
f. Spin your two column and collection tube assemblies for 1 minute at room temperature in a
bench microfuge set at maximum speed (14,000 rpm).
g. Remove the column labelled PCR1 from the collection tube labelled WASTE 1 and place in a new
2 ml collection tube labelled WASTE 2.
h. Remove the column labelled PCR2 from the collection tube labelled WASTE 1 and place in a new
2 ml collection tube labelled WASTE 2.
i. Add 750 µl Buffer PE to each of your two MiniElute columns. Spin the two column/collection tube
assemblies for 1 minute at room temperature in a bench microfuge set at maximum speed (14,000
rpm).
Cross section of MinElute column MinElute column and collection tube
Page 26 of 45
j. Remove the column labelled PCR1 from the collection tube labelled WASTE 2 and place in a new 2
ml collection tube labelled WASTE 3.
k. Remove the column labelled PCR2 from the collection tube labelled WASTE 2 and place in a new
2 ml collection tube labelled WASTE 3.
l. Spin the two column/collection tube assemblies for 1 minute at room temperature in a bench
microfuge set at maximum speed (14,000 rpm).
NOTE. This second spin is important to remove any residual ethanol which is in buffer PE.
m. Cut the lid off a new 1.5 ml tube and label the tube purified PCR1 and your name.
Remove the column labelled PCR1 from the used 2 ml collection tube labelled WASTE 3 and place
the column in the new 1.5 ml tube labelled purified PCR1 and your name.
n. Cut the lid off a new 1.5 ml tube and label the tube purified PCR2 and your name. Remove the
column labelled PCR2 from the used 2 ml collection tube labelled WASTE 3 and place the column in
the new 1.5 ml tube labelled purified PCR2 and your name.
CONCENTRATE you are now about to elute your purified PCR DNA from the columns.
o. Add 20 µl sterile dH2O directly to the centre of the membrane of your PCR1 column.
Add 20 µl sterile dH2O directly to the centre of the membrane of your PCR2 column.
Let the two column/1.5 ml tube assemblies stand for 1 minute at room temperature.
p. Spin the two column/1.5 ml tube assemblies for 1 minute at room temperature in a bench
microfuge set at maximum speed (14,000 rpm).
Check the bottom of each tube, you should see ~ 20 μl there. If you cannot see ~ 20 μl please
see the academic for advice.
q. Label a new 1.5ml tube (with lid) purified ADE2 PCR1 and your full name. Remove the PCR1
column and transfer the approx. 20 µl of your now purified ADE2 PCR1 to the new 1.5 ml tube
labelled purified ADE2 PCR1 and your full name.
Place the tube labelled purified ADE2 PCR1 on ice – you will need it for later steps.
r. Label a new 1.5ml tube (with lid) purified ADE2PCR2 and your full name. Remove the PCR2
column and transfer the approx. 20 µl of you now purified ADE2 PCR2 to the new 1.5 ml tube
labelled purified ADE2 PCR2 and your full name.
Place the tube labelled purified ADE2 PCR2 on ice – you will need it for later steps.
Page 27 of 45
Part 3. Analysis of purified ADE2 PCR products using agarose gel electrophoresis
a. Label two new 1.5 ml tubes Tube 1 purified PCR1 for gel and Tube 2 purified PCR2 for gel.
b. Add the following ingredients to your labelled tubes using a new tip for each addition. Start with
dH2O and then work down the table adding ingredients in the order they appear. Tick off each
ingredient on the list as you add it to the tube.
Tube 1 purified
PCR1 for gel
Tube 2 purified
PCR2 for gel
dH20 8 µl 8 µl
sample 2 µl
purified ADE2 PCR1
2 µl
purified ADE2 PCR2
6xBO dye 2 µl 2 µl
TOTAL 12 µl 12 µl
MAKE sure the rest of your purified PCR 1 and PCR2 and safely stored on ice because you need
them to make your DNA sequencing samples later.
c. Wearing nitrile gloves remove the comb gently from your gel. Carefully remove the tape from
each end of the gel tank keeping the tray horizontal. Place the gel tray into the tank with the wells
furthest from you. Make sure wells are at black (-ve) end of tank (put lid on to check this). Add
some more 1xTAE until gel is just covered.
d. Load your 1% w/v agarose gel as follows. Your loading order for the gel should be
Lane 1 Lane 2 Lane 3 Lane 4 Lane 5 Lane 6 Lane 7 Lane 8
1 kb plus
10 µl
Tube 1
purified
PCR1 for
gel
12 µl
Tube 2
purified
PCR2 for
gel
12 µl
Page 28 of 45
e. Place the lid on the gel tank connecting the negative electrode (black) on the side nearest to the
sample wells (the DNA molecules will migrate from the negative towards the positive electrode).
The positive (red) electrode is connected at the other end of the gel. Switch the power pack on and
set at a constant voltage of 120V. Look at the electrodes, more bubbles at the -ve end indicate that
the circuit is complete and current running in correct direction.
The gel needs to be turned off when the dark blue marker dye is at the end of the gel (about 50
minutes).
e. Your gel will need to be photographed. STAPLE YOUR GEL PHOTO IN THE SPACE PROVIDED ONE
BELOW TO KEEP IT SAFE. If you lose your gel photo you will lose marks on your practical write up.
1 kb plus DNA ladder (Invitrogen)
https://www.thermofisher.com/order/catalog/product/10787018?SID=srch-srp-10787018
STAPLE YOUR GEL PHOTO
HERE BEFORE YOU LEAVE
THE PRACTICAL CLASS SO
YOU DO NOT LOSE IT
NOTE. The 1.5 kb (1500 bp) DNA fragment
of this DNA marker should appear brighter
(known as the reference band). You are
unlikely to resolve the 7 to 15 kb DNA
marker fragments on a 0.8% 1xTAE
agarose mini gel and you may have run the
smaller marker DNA fragments (100 to 300
bp) off the end of the gel, so the 1.5 kb
reference band is a useful starting point
when you identify the sizes of the DNA
marker fragments on your gel photograph.
Page 29 of 45
Part 4. Measuring DNA concentration of your purified ADE2 PCR products using the nanodrop
technique and preparation of sample for DNA sequencing
You need to measure the concentration of both your purified PCR products in tubes labelled
purified ADE2 PCR1 and purified ADE2 PCR2.
a. A demonstrator will place a 2 µl drop of both your purified ADE2 PCR1 onto the surface of the
nanodrop machine and take a reading. The process will be repeated with your purified ADE2 PCR2.
The demonstrator will give you a printout of your two DNA concentration reading.
Record the following information in the table below.
purified ADE2 PCR1 purified ADE2 PCR1
DNA concentration (ng/µl)
Ratio 260/280
b. Now you need to do one of three thing’s depending on each purified ADE2 PCR DNA
concentration. You will need to prepare two 1.5 ml tubes containing 15 μl of 20 ng/μl of your
purified ADE1 and purified ADE2 PCR product for DNA sequencing.
First label a new 1.5 ml tube with your name and DNA sequencing sample PCR1.
And label a second 1.5 ml tube with your name and DNA sequencing sample PCR2.
Then do one of the three following options depending on your DNA concentration measured by the
nanodrop machine.
A. If your purified ADE2 PCR DNA is already 20 ng/µl (+ or -10%) you need to pipette 15 µl into the
new 1.5 ml tube labelled with your name and DNA sequencing sample and take it to the specified
academic/demonstrator.
OR
B. If your purified ADE2 PCR DNA is more than 20 ng/µl you need work out how to create at least
15 µl of 20 ng/µl by diluting some of your purified ADE2 PCR DNA with water.
NOTE. You can send more than 15 µl of 20 ng/µl if the way you work out the dilution it is easier to
create a slightly bigger volume. UNDER NO CIRCUMSTANCES ATTEMPT TO PIPETTE LESS THAN 1
µL IN VOLUME.
Page 30 of 45
Example calculations
So say your DNA is 80 ng/µl
80 = 4.0 so a 1 in 4.0 dilution (or a 4 in 16 dilution or a 8 in 32 dilution etc.)
20
So in a new 1.5 ml tube add 4 μl of your purified PCR to 12 μl of sterile water (16 – 4 = 12 μl)
Label the whole 16.0 μl for sequencing (does not matter it is more than 15 μl in total volume).

OR
C. If your purified ADE2 PCR DNA reading is much less 20 ng/µl see the lead academic with both
your gel photo and your nanodrop reading for advice.
Write your calculations below so you have a record
c. Take two 1.5 ml tubes labelled with your name and DNA sequencing sample 1 and 2 to the
specified academic/demonstrator. The member of staff will attach a bar code sticker to each of
your tubes and give you a sticker with the bar code number. You need to keep a note of these as
you will need your bar code number to identify your DNA sequencing data in the class folder later.
Place your ADE2 DNA sequencing sample PCR1 sticker here…………………………………………………
Place your ADE2 DNA sequencing sample PCR2 sticker here…………………………………………………
Page 31 of 45
Preparation notes for practical
Quality of reagents and water
All chemicals are Analar or Molecular Biology or Electrophoresis grade. All water must come from
deionised water machine and be 18 m quality (molecular biology grade).
Deionised water from the taps in labs can ONLY be used for media and for rinsing equipment and
glassware.
Quality of solutions, media, glassware and plastic ware
It is usually essential that reagents, solutions, media, glassware and plastic ware used in this
practical are not contaminated the following otherwise a particular method will fail.
a. DNA
b. DNase activity
c. RNase activity
d. Endonuclease activity
e. Protease activity
f. Microorganisms
g. Detergents
Sterile dH2O
2x 200 mls in Duran bottle. Autoclave.
All water must come from deionised water machine and be 18 m quality (molecular biology
grade).
Page 32 of 45
Day 1
Yeast competent cells
The following yeast strains are suitable S288C or BY4741
Y10000 was obtained from Dr Barry Panaretou. In future can use an aliquot of competent cells
stored at -70°C as source.
http://www.euroscarf.de/search.php?search=y10000&project=&selectedProject=
Y10000 is ACCNO Y10000, strain BY4742 (S288C isogenic yeast strain: MATalpha; his3D1; leu2D0;
lys2D0; ura3D0).
Method taken from Sehgal, N., Sylves, M. E., Sahoo, A., Chow, J., Walker, S. E., Cullen, P. J., & Berry,
J. O. (2018). CRISPR Gene Editing in Yeast: An Experimental Protocol for an Upper-Division
Undergraduate Laboratory Course. Biochemistry and molecular biology education : a bimonthly
publication of the International Union of Biochemistry and Molecular Biology, 46(6), 592–601.
https://doi.org/10.1002/bmb.21175
Makes total of 12 ml 15 ml yeast competent cells (100 µl per student required)
After you harvest the cells steps 4 to 9 must be done as quickly as possible.
1. Prior to making yeast competent cells streak yeast strain to single colonies on YPD agar plate
and incubate.
2. Inoculate a freshly grown single colony into 35 ml 50 ml sterile YPD in a sterile 250 ml
conical flask and grow shaking overnight at 30°C until saturation.
3. Transfer all the 35 ml 50 ml overnight culture to 770 ml 950 ml YPD (suggest 25 ml O/N
culture in each of 2 x sterile 500 ml YPD in sterile 2 litre conical flasks) then grow shaking
30°C and check OD600 every 2 hrs until culture mid-log phase (OD600 ~0.6).
4. Pellet cells in a centrifuge. Could divide between 50 ml sterile Falcon tubes and use bench
centrifuge max speed 15 minutes).
5. Resuspend the cell pellets from 800 ml 1000 ml culture in a total of 6 ml 7.5 ml (total
volume) ice cold PLATE on ice. Pool the 6 ml 7.5 ml cell suspension in a sterile 50 ml Falcon
tube. N.B. important to keep cells on ice from now onwards.
6. Add 6 ml 7.5 ml ice cold 40% v/v glycerol on ice to the 7.5 ml of yeast cells and mix by
inverting tube (do not vortex).
7. Label 120 150 x 1.5 ml tubes with yeast on lid and place on ice.
8. Aliquot 100 µl competent cells into the bottom of 120 150 x 1.5 ml tubes on ice.
9. Store the tubes immediately at -70°C in storage boxes with lid (labelled yeast competent
cells for 5BBG0204 and date and your name)
After freezing at -70°C you will need to test one aliquot of the batch of competent cells using day
1 method (expecting 100/150 wild type colonies and 5-20 ADE2 pink colonies).
Page 33 of 45
PLATE solution
PLATE solution 10 ml
40% PEG (w/v) 8 ml stock is 50% w/v PEG 3350
100 mM Lithium acetate 1 ml stock is 10x LiAc
10 mM Tris pH 8.0 1 mM EDTA 1 ml stock is 10x TE
Prepare fresh just prior to use from stock solutions below.
1. 50% w/v PEG 3350 (Polyethylene glycol, avg. mol. wt. = 3,350; Sigma Cat No. P-3640) prepare
with molecular biology grade deionized H2O in sterile Duran bottle. Filter sterilize.
2. 10x TE buffer: 0.1 M Tris-HCl, 10 mM EDTA, pH 7.5. Autoclave.
3. 10x LiAc: 1 M lithium acetate (Sigma Cat No. L-6883) Adjust to pH 7.5 with dilute acetic
acid and autoclave.
40% v/v glycerol 100 ml
Glycerol 40 ml
Deionised H20 60 ml
Mix and autoclave.
Kanamycin (for pCASgRNA in E. coli)
https://www.sigmaaldrich.com/catalog/product/sigma/k1377?lang=en&region=GB&cm_sp=Insite-
_-caSrpResults_srpRecs_srpModel_kanamycin-_-srpRecs3-1
Sigma K1377 – Kanamycin sulfate from Streptomyces kanamyceticus K1377-1G 1 g £38.60
Final conc is 50 µg/ml in media
1000x Kanamycin stock (50 mg/ml) 5 ml
Kanamycin sulfate 250 mg
dH2O 5 ml
Make in small beaker. Filter sterilise through a sterile Acrodisc into a 20 ml sterile Universal bottle.
NOTE. Store solution in aliquots at -20°C for up to six months. Freeze in user friendly aliquots.
Add 100 μl of filter sterilised 50 mg/ml kanamycin (that has just been thawed) per 100 ml of media
when media has cooled to 60C.
Page 34 of 45
G418 (for pCASgRNA in Yeast)
https://www.sigmaaldrich.com/catalog/product/sigma/a1720?lang=en&region=GB&cm_sp=Insite-
_-caSrpResults_srpRecs_srpModel_g418*-_-srpRecs3-1
Sigma A1720 – G418 disulfate salt A1720-1G 1 g £69.50
The G 418 powder is stable for three years as supplied when stored at 2-8 °C.
G418 at final conc 200 mg/l (Ryan et al. 2014)
200mg/liter = 0.2 mg/ml or 200 µg/ml
250x G418 stock (50 mg/ml) 5 ml
Kanamycin sulfate 250 mg (1 g)
dH2O 5 ml
Make in small beaker. Filter sterilise through a sterile Acrodisc into a 20 ml sterile Universal bottle.
NOTE. Can store solution in aliquots at -20°C for up to six months. Freeze in user friendly aliquots.
Add 400 μl of filter sterilised 50mg/ml G418 (that has just been thawed) per 100 ml of media when
media has cooled to 60C.
Page 35 of 45
YPD broth
From Formedium

YPD Broth

YPD medium (YEPD) is a complex medium for routine growth
SKU Pack Size Price
CCM0202 250g €25.73
CCM0205 500g €45.26
CCM0210 1000g €78.48
Make YPD according to manufacturers instructions. Autoclave.
For YPD agar
Add 2% w/v agar
2 g per 100 ml media.
Microspec™ Sterile Plastic Inoculation Loops (Volume: 1μL)
Or similar sterile plastic inoculating 1μL loop
https://www.fishersci.co.uk/shop/products/sterile-plastic-inoculation-loops-volume-1-l-4/p7112469
100 ng/µl pCASgRNA
pCASgRNA full name is pCAS-ADE2-gRNA1
Dilute some of maxiprep to 100 ng/µl (enough to create 13 µl of 100 ng/µl pCASgRNA per student
and 10% spare).
How much pCAS-ADE2-gRNA1 do we need each year approximately?
13x 100 ng = 1300 ng per student (1.3 µg per student).
For 120 students would need 120 x 1.3 µg = 156 µg (plus 10% for spares)
Need giga prep of pCAS-ADE2-gRNA1 plasmid from Genewiz.
https://www.genewiz.com/en-GB/Public/Services/Plasmid-DNA-Prep/Standard
10 mg/ml ssDNA
Sigma D9156-1ML Deoxyribonucleic acid, single stranded from salmon testes
1 ml £55.40
Page 36 of 45
PfuUltra II Hotstart PCR 2x Master Mix
https://www.agilent.com/cs/library/usermanuals/public/600850.pdf
Purchased from Aligent Technologies.
Cat number – 600850 for 100 reactions or 600852 for 400 reactions
On delivery take out of dry ice and store at -20°C. On first use thaw to 4°C, mix the container
several times by inversion and then briefly vortex to ensure homogeneity. Keep the stock on ice
while aliqouting into tubes also kept on ice. Store the thawed PfuUltra II Hotstart PCR 2x Master
Mix stock and subsequent aliquots at 4°C (DO NOT RETURN ANY THAWED MASTER MIX TO -20°C).
The thawed master mix is stable at 4°C for 6 months. Place on ice just before use in class.
200 ng/µl HDR fragment
Step 1. PCR amplification of HDR fragment from pUCGWamp-ADE2-HDR
You need pUCGWamp-ADE2-HDR to amplify 131 bp HDR fragment using PCR. Do one 50 µl PCR per
student (plus 10% extra) to get enough for class. The 131 bp HDR fragment needs to be column
purified and supplied to class at 200ng/µl conc. Each student needs 15 µl of 200 ng/µl HDR
fragment.
The following primers are used:
AdeRepairfor 5’ CGGACAAAACAATCAAGTATGGATTCTAGAAC 3′(Tm = 59°C)
AdeRepairrev 5’ GGAGAATTTTCAGCATCTAGTATTACCGTC 3′(Tm = 59°C)
Add sterile deionised water to add to each dried down oligo to make a 100 μM stock solution.
Then make a smaller working stock of 10 μM for the PCR below. Store all primers at -20°C.
For 1 For 100 For ………….
Sterile dH2O 23 µl 2300 µl
10 μM AdeRepairfor 1 µl 100 µl
10 μM AdeRepairfor 1 µl 100 µl
pUCGWamp-ADE2-HDR
Depends on conc.
X µl
(10 ng total)
X µl
(1000 ng total)
PfuUltra II Hotstart PCR 2x
Master Mix
25 µl 2500 µl
TOTAL VOLUME 50 µl 5000 µl
Very carefully make a single PCR mix containing all components (see table above) then aliquot 50 µl
into each PCR tube and place in PCR machine.
The program for PCR
Step 1: 95 °C for 2 minutes.
Step 2: 95 °C for 20 seconds, 54 °C for 20 seconds, 72 °C for 15 seconds. Repeat Step 2 for 30 cycles.
Step 3: 72 °C for 3 min.
Page 37 of 45
Step 4: 4 °C hold
Step 2. Agarose gel analysis of PCR
As each of the 100 plus PCR tubes should be identical because they are all contain an aliquot of the
same PCR mix if one has worked all have worked. So just test 4 (two from each PCR machine).
Set up four 1.5 ml tubes containing the following ingredients
Tube 1 for gel Tube 2 for gel Tube 3 for gel Tube 3 for gel
dH20 5 µl 5 µl 5 µl 5 µl
sample 5 µl
PCR1
5 µl
PCR2
5 µl
PCR3
5 µl
PCR3
6xBO dye 2 µl 2 µl 2 µl 2 µl
TOTAL 12 µl 12 µl 12 µl 12 µl
Store all the PCR tubes at -20°C until you are ready to purify the PCR fragment.
Load a 1xTAE 1% w/v agarose gel as follows.
Lane 1 Lane 2 Lane 3 Lane 4 Lane 5 Lane 6 Lane 7 Lane 8
1 kb plus
10 µl
Tube 1 for
gel
12 µl
Tube 2 for
gel
12 µl
Tube 3 for
gel
12 µl
Tube 4 for
gel
12 µl
You are expecting a PCR product (HDR fragment) that is 131 bp in size so stop running the gel when
the yellow dye is about 1 cm from the end of the gel. Be very careful you do not mix up 131 bp HDR
fragment with any primer dimers which run about 100 bp.
Page 38 of 45
Step 3. PCR purification, agarose gel and nanodrop analysis
a. You should use Day 4. Part 2. Purification of ADE2 PCR products with the Qiagen MiniElute PCR
Purification kit to purify each PCR eluting with 20 µl sterile dH2O. Store at -20°C.
b. As each of the 100 plus purified PCR 1.5 ml tubes should be identical just test 4 (suggest one from
each batch purified) using agarose gel and nanodrop.
i. Set up four 1.5 ml tubes containing the following ingredients
Tube 1 for gel Tube 2 for gel Tube 3 for gel Tube 3 for gel
dH20 5 µl 5 µl 5 µl 5 µl
sample 2 µl
Purified PCR1
2 µl
Purified PCR2
2 µl
Purified PCR3
2 µl
Purified PCR4
6xBO dye 2 µl 2 µl 2 µl 2 µl
TOTAL 12 µl 12 µl 12 µl 12 µl
Load a 1xTAE 1% w/v agarose gel as follows.
Lane 1 Lane 2 Lane 3 Lane 4 Lane 5 Lane 6 Lane 7 Lane 8
1 kb plus
10 µl
Tube 1 for
gel
12 µl
Tube 2 for
gel
12 µl
Tube 3 for
gel
12 µl
Tube 4 for
gel
12 µl
You are expecting a PCR product (HDR fragment) that is 131 bp in size so stop running the gel when
the yellow dye is about 1 cm from the end of the gel. Be very careful you do not mix up 131 bp HDR
fragment with any primer dimers which run about 100 bp.
ii. Measure nanodrop concentration of the same four purified PCR you are running on agarose gel.
Store purified PCR products at -20°C.
Page 39 of 45
Step 4. Pooling purified PCR prior to aliquoting for class
It is important each student gets identical aliquoted of purified PCR HDR fragment which all have
the same concentration.
Pool all the ~20 µl purified PCRs into one 1.5 ml tube, mix and measure concentration with
nanodrop. Before proceeding to next step tell Shirley nanodrop reading.
Measure total volume of purified PCR HDR fragment using a Gilson pipette.
Add sterile dH2O to give a total volume of xxx (depends on total volume need for class with 15%
spares).
Store aliquots at -20C.
Page 40 of 45
Zymo Research YeaStar Genomic DNA kit
Cambridge Bioscience
https://www.bioscience.co.uk/find/?search=D2002&productgrp=ASSAYS&supplierid=38
https://files.zymoresearch.com/protocols/_d2002__yeastar_genomic_dna_kit.pdf
Zymo Research YeaStar Genomic DNA kit D2002 40 preps £137.00
YD Digestion Buffer D2002-1 4.8 ml £22.00 (N.B. can buy extra if required)
YD Lysis Buffer D2002-2 4.8 ml £39.00 (N.B. can buy extra if required)
E1005 Zymolyase 2000 U
E1004 Zymolyase 1000 U
R-Zymolyase
Please note 1,000 units R-Zymolyase™ needs to be stored at -20°C because it is a protein/enzyme.
Add 200 µl kit supplied storage buffer to lyophilized enzyme, mix, centrifuge briefly and store -20°C.
Ethanol required for DNA wash buffer
You need to add ethanol (96-100% must be VWR Analar or similar very pure grade) to the DNA
wash buffer before use. Use a sterile 50 ml Falcon tube as a measuring cylinder to prevent
contamination of buffer AW1 and buffer AW2 solutions.
Add 24 ml 96-100% ethanol to the DNA wash buffer.
Safety note
R-Zymolyase contains beta-mercaptoethanol.
YD Lysis Buffer contains Chaotropic salt. Irritant. Handle with care.
The shelf life of all solutions in this kit is 12 months so must be brought new every year.
Page 41 of 45
Qiagen MinElute PCR Purification Kit
https://www.qiagen.com/gb/shop/sample-technologies/dna/genomic-dna/minelute-pcrpurification-kit/#orderinginformation
Cat No./ID: 28004 MinElute PCR Purification Kit (50) £95.00
50 MinElute Spin Columns, Buffers, Collection Tubes (2 ml)
Cat No./ID: 28006MinElute PCR Purification Kit (250) £440.00
250 MinElute Spin Columns, Buffers, Collection Tubes (2 ml)
Please note all kit ingredients are only stable if stored at the right temperature for 12 months. Kits
and other kit related solutions need to be brought new for each class.
Ethanol
You need to add ethanol (96-100% must be VWR Analar or similar very pure grade) to buffer PE
(see bottle label). Use a sterile 50 ml Falcon tube as a measuring cylinder to prevent contamination
of buffer PE solutions.
You can also order following separate solutions from Qiagen if required.
19066 Buffer PB 500 ml Binding Buffer PB
19065 Buffer PE 100 ml Wash Buffer PE (needs ethanol)
Storage
Upon arrival, open the kit and store MinElute spin columns at 2–8°C. The remaining kit
components can be stored at room temperature (15–25°C). Under these conditions,
MinElute Kits can be stored for up to 12 months without showing any reduction in
performance and quality. Check buffers for precipitate before use and redissolve at 37°C
if necessary. Make sure that all buffers are at room temperature when used.
Buffer PB preparation
Add 1:250 volume pH indicator I to Buffer PB (i.e., add 120 µl pH indicator I to 30 ml Buffer PB or
add 600 µl pH indicator I to 150 ml Buffer PB) (as instructed by the kit manual).
The yellow colour of Buffer PB with pH indicator I indicates a pH of 7.5.
Buffer PE preparation
Add ethanol AR grade (96–100%) to Buffer PE before use (see bottle label for volume).
The shelf life of all solutions in this kit is 12 months so must be brought new every year.
Page 42 of 45
Below copied from Qiagen Mini-eulte Handbook for Qiagen MinElute PCR Purification Kit
(version March 2008) – downloaded January 2019
https://www.qiagen.com/gb/resources/resourcedetail?id=fa2ed17d-a5e8-4843-80c1-
3d0ea6c2287d&lang=en
Page 43 of 45
Agarose gel electrophoresis tanks/tray/combs
Each set up must be checked for the following
1. Comb is positioned at highest position on bridge and the screws are tightened.
2. Tray open sides do not have chipped edges.
3. Tray has one line of red or green or black coloured tape at one end under the well line
(yellow makes it too difficult for students to see empty wells).
4. Trays should be smaller length variety otherwise the agarose gel recipe given in this
schedule is not correct.
10xTAE
Buy 10xTAE (any supplier) and dilute to 1xTAE using molecular biology grade dH2O for use in class.
Does not need to be sterile just made using clean containers, measuring cylinders.
1 kb plus DNA ladder (Invitrogen)
https://www.thermofisher.com/order/catalog/product/10787018?SID=srch-srp-10787018
1 kb plus DNA ladder (25ng/µl) in 1x BO dye (for Gel Red) 1 ml (1000 µl)
1 kb plus ladder (Invitrogen) (stock 0.5 g/l) 25 l
Promega 6x Blue/Orange Loading Dye 170 l (will be ~1x)
sterile dH2O 805 l
Mix well and then aliquot. Store aliquots at –20C.
Load 10 µl per 4 mm lane on agarose gel (so 250 ng loaded per lane for GelRed containing agarose)
1 kb plus DNA ladder (Invitrogen) consists of linear double stranded DNA fragments and is heat labile
so should not be left for long periods at ice/room temperature.
1 kb plus DNA ladder (Invitrogen) from ThermoFisher
10787018 (also known as 10787-018) 250 µg £156.00
10787026 (also known as 10787-026) 1000 µg £560.00
Do not substitute for any other ‘1 kb’ marker they are not the same.
N.B. This is new DNA marker for semester B 2018-2019 onwards.
N.B. The new DNA marker information has also been changed in the 2018/19 5BBG0203 practical
handbook, practical guidelines documents and practical 1 proformas.
Promega 6x Blue/Orange Loading Dye (for Practical 2 and Practical 3)
https://www.promega.co.uk/products/biochemicals-and-labware/biochemical-buffers-andreagents/blue_orange-loading-dye_-6x/?catNum=G1881
Promega 6x Blue/Orange Loading Dye G1881 £ 37.00 (for 3 ml)
Store at -20°C.
Page 44 of 45
Biotum GelRed Nucleic Acid Stain in water (x10000)
Cambridge Bioscience
https://www.bioscience.co.uk/cpl/gelred-nucleic-acid-gel-stain
https://www.bioscience.co.uk/resources/gelred-nucleic-acid-gel-stain-protocol.pdf
BT41003 1x 0.5 ml £103.00
BT41003-5 5x 0.5 ml £455.00
Store 10,000X solution of GelRed™ at room temperature, protected from light. Dye precipitation
may occur at lower temperatures, resulting in lower signal or the appearance of precipitate on the
surface of the gel. If this occurs, heat the solution to 45-50°C for two minutes and vortex. GelRed™
is stable for at least one year from the date it is received.
100 μM stock solutions of primers (oligonucleotides or oligos)
Primers (oligonucleotides or oligos) can be ordered from a number of companies. However I prefer
Sigma because the oligos are delivered with note which tell you exactly how much sterile deionised
water (see previous notes on water quality) to add to each dried down oligo to make a 100 μM
stock solution.
Read Sigmas supplied note and add the right amount of sterile deionised water to the right primer
tube (N.B. the volume will vary based on exactly how much dried primer was made in that run in
that tube). Briefly vortex each tube to make sure the dried oligo in evenly dissolved in the sterile
deionised water.
You must store all 100 μM oligo stock solutions at -20˚C.
New primers should be ordered every year for each class and new 100 μM stock solutions created
before the working stocks diluted for each class.
You should use Filter tips and new nitrile gloves and a virgin source of sterile dH2O to prevent oligo
stock solutions being contaminated with DNA and microorganisms.
Page 45 of 45
ADE2 Primer mix (2 μM final concentration)
In class two different primers are combined to make a 2 μM single stock of both the ADE2mutfor
and ADE2revfor primers called ADE2 primer mix that is then aliquoted.
The primer names and sequences for 5BBG0204 Practical are below.
Primer name Primer sequence 5’ to 3’ Tm
ADE2mutfor CGTTGGATCTCTCTTCTAAGTACATCCTAC 60°C
ADE2mutrev CGTATGCCAAAGTCCTCGACTTCAAG 60°C
ADE2 Primer mix (2 µM) 1000 µl
Primer ADE2mutfor (stock 100 µM) 20 µl
Primer ADE2mutrev (stock 100 µM) 20 µl
sterile dH2O 960 µl
100μM to 2μM is a 1 in 50 dilution.
Combine the above ingredients using Filter tips and new nitrile gloves and a virgin source of sterile
dH2O to prevent oligo stock solutions being contaminated with DNA and microorganisms in a sterile
1.5 ml tube. Briefly vortex each tube to make sure all the ingredients are evenly mixed together.
Aliquot the ADE2 primers on ice using filter tips and new nitrile gloves prevent ADE2 primer mix
stock from being contaminated. Must store at -20°C. Place on ice just before use in class.
ADE2mutfor sequencing primer (5 µM)
The ADE2mutfor sequencing primer needs to be sent with the two class sets of DNA samples to
Genewiz. It contains one primer ADE2mutfor. You need to send XX µl with each of the DNA
sequencing batches (Genewiz minimum 10 µl 5 mM sequencing primer per DNA sample)
ADE2mutfor sequencing primer (5 µM) 600 µl
Primer ADE2mutfor (stock 100 µM) 30 µl
sterile dH2O 570 µl
100μM to 5μM is a 1 in 20 dilution.
Combine the above ingredients using Filter tips and new nitrile gloves and a virgin source of sterile
dH2O to prevent oligo stock solutions being contaminated with DNA and microorganisms in a sterile
1.5 ml tube. Briefly vortex each tube to make sure all the ingredients are evenly mixed together.
Must store at -20°C. Label ADE2mutfor primer (5 µM) for DNA sequencing, volume and date.
Store in separate box labelled DNA sequencing primers to ADE2 Primer mix to ensure no confusion.